Method of diagnosis of colorectal cancer

Varování

Publikace nespadá pod Lékařskou fakultu, ale pod Středoevropský technologický institut. Oficiální stránka publikace je na webu muni.cz.

Autoři

SLABÝ Ondřej VYCHYTILOVÁ Petra SVOBODA Marek ŠACHLOVÁ Milana

Rok publikování 2020
Druh Patent
Fakulta / Pracoviště MU

Středoevropský technologický institut

Vydavatel European Patent Office
Stát vydání Německo
Číslo patentu EP3431609B1
www odkaz na stránku Evropského patentového úřadu
Popis The present invention relates to a method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The biomarker can be combined with other piRNAs or miRNAs. The resulting method uses a body fluid as the input, and therefore is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.
Související projekty:

Používáte starou verzi internetového prohlížeče. Doporučujeme aktualizovat Váš prohlížeč na nejnovější verzi.

Další info